FASTA format is a standard format for encoding DNA or protein sequences. A FASTA file generally contains one or more sequences in FASTA format. A single sequence is described by a title line followed by one or more data lines. The title line begins with a right angle bracket followed by a label. The label ends with the first white space character. Everything after that on the first line is considered a comment. The data lines begin right after the title line and contain the sequence characters in order. Each data line except the last should be exactly 60 letters long, although many programs allow a little flexibility on that score.
The first ProteinEncodingGene of Staph aureus MRSA 252 is shown in FASTA format. The letters in this example are amino acid codes? .
>fig|393133.3.rna.1 ggagaaatacccaagtccggctgaaggggacagactcgaaatctgttaggtggtgtatgc cgcgccggggttcgaatccccgtttctccg >fig|393133.3.rna.2 gggttgttagctcagttggtagagcagctgactcttaatcagcgggtcgggggttcgaaa ccctcacaaccca >fig|393133.3.rna.3 gcccatatagttaaacggatataacaagcccctcctaagggctagttcgtggttcgattc cgcgtatgggcg >fig|393133.3.rna.4 gccgctttagctcagttggtagagcacttccatggtaaggaaggggtcgtcggttcaaat ccgacaagtggct >fig|393133.3.rna.5 gtcctgatagctcagctggatagagcaacggccttctaagccgtcggtcgggggttcgaa tccctctcaggacg >fig|393133.3.rna.6 gagccgttagctcagttggtagagcatctgacttttaatcagagggtcgctggttcgaac ccagcacggctca >fig|393133.3.rna.7 gccggcttagctcagttggtagagcaactgatttgtaatcagtaggtcgcgagttcgact cttgcagccggca >fig|393133.3.rna.8 ggggaagtactcaagtggctgaagaggtgcccctgctaagggtataggtcgctcgcgcgg cgcgagggttcaaatccctccttctccg
Topic revision: r1 - 21 May 2008 - 08:07:01 - BruceParrello
NMPDR is a collaboration among researchers from the Computation Institute of the University of Chicago, the Fellowship for Interpretation of Genomes (FIG), Argonne National Laboratory, and the National Center for Supercomputing Applications (NCSA) at the University of Illinois. NMPDR is funded by the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contract HHSN266200400042C. Banner images are copyright © Dennis Kunkel.